Tattoo Trouble: A Case of Drug-induced Thrombocytopenic Purpura

Tattoo Trouble: A Case of Drug-induced Thrombocytopenic Purpura

Trimethoprim-sulfamethoxazole, in any other case often known as Bactrim or Septra, is a generally prescribed antibiotic for delicate tissue infections. Drug-induced thrombocytopenia is a uncommon however critical hostile response to sulfonamide antibiotics like Bactrim/Septra. A 34-year-old energetic responsibility marine male with no vital previous medical historical past offered with a chief criticism of a rash on his decrease extremities. The affected person acknowledged that 2 weeks earlier, he was prescribed Bactrim for cellulitis on the web site of a brand new tattoo. The intern famous a petechial rash that was pathognomonic for thrombocytopenia. Laboratory testing confirmed the affected person’s thrombocytopenia with platelets of 2,000/μL on preliminary full blood rely, with out pancytopenia or different coagulopathies.

The blood smear indicated a profound lack of platelets however in any other case regular cell counts and morphology. In the emergency division, the affected person was typed and crossed, platelets have been ordered, and hematologyoncology was consulted. Once admitted to the inner medication ward, he was administered glucocorticoids in addition to platelet transfusions. He was monitored for three days and discharged with a prognosis of resolved drug-induced thrombocytopenia. This case illustrates the significance of conducting a radical evaluation of programs and bodily examination in secure and in any other case wholesome sufferers.

In this case, the seemingly benign rash was one of the one scientific indicators of extreme thrombocytopenia, with a excessive threat of spontaneous bleeding in clinically vital organ programs. It is essential to acknowledge immune thrombocytopenic purpura as a possible complication of Bactrim/Septra, as this antibiotic is broadly utilized by army suppliers in operational settings. Many elements support in deciding on a specific course of remedy, together with efficacy, security, entry to remedy, adherence, and out-of-pocket price of remedy. Until not too long ago, most cancers remedy consisted primarily of IV infusion remedy, however oral oncolytic brokers have been added to the remedy choices over the previous a number of years.

Health-care employees underscore their considerations in regards to the prevalence of points associated to oral oncolytic remedy, by reporting on the incidence of abandonment of remedy, delay in remedy initiation, sources wanted to guarantee affected person entry to oral oncolytic brokers, and affect on affected person care. Patients recognized with most cancers require immediate entry to applicable remedies to supply favorable outcomes. In many situations, sufferers are unable to grasp the intensive course of concerned in figuring out an applicable course of therapy.

A Multicentered Academic Medical Center Experience of a Simulated Root Cause Analysis (RCA) for Hematology/Oncology Fellows

Quality enchancment and affected person security training is an Accreditation Council for Graduate Medical Education (ACGME) widespread program requirement for hematology/oncology fellowships. Interprofessional scientific affected person security actions, comparable to root trigger analyses (RCA), may be difficult to include into busy schedules. We report on a multicentered expertise using a simulated RCA instructional module in an try to supply fellows with the instruments wanted to take part in a dwell RCA and to extend consciousness of the necessity to analyze affected person security occasions.

The 2-h module included a didactic session explaining the fundamentals of an RCA together with widespread terminology, efficient chart evaluation, and private interviews. The fellows assessed a affected person security occasion of a missed coagulopathy and created an occasion stream map and fishbone evaluation. About 70% of respondents felt that in consequence of the mock RCA, they have been extra more likely to report a close to miss or hostile occasion and have been extra more likely to be thorough of their documentation.

They then shaped root trigger/contributing issue statements and proposed an answer. Twenty-three fellows from two establishments accomplished the expertise. There was a major distinction in fellow reported consolation with collaborating in a dwell RCA (p = 0.03), and in using the instruments of an RCA following the mock RCA expertise (p = 0.005). Mock RCAs are a possible methodology of incorporating ACGME-required affected person security actions into hematology/oncology fellow training and are efficient in rising their consolation and understanding of essential high quality enchancment abilities.

Tattoo Trouble: A Case of Drug-induced Thrombocytopenic Purpura

Training pediatric hematologist/oncologists for capability constructing in Ethiopia

A appreciable barrier to world pediatric oncology efforts has been the shortage and even absence of skilled professionals in lots of low- and middle-income nations, the place the bulk of kids with most cancers reside. In 2013, no devoted pediatric hematologyoncology (PHO) packages existed in Ethiopia regardless of the estimated annual incidence of 6000-8000 instances. The Aslan Project initiative was established to fill this hole with a view to enhance pediatric most cancers care in Ethiopia.
A main goal was to extend subspecialty PHO-trained physicians who have been dedicated to training domestically and empowered to steer programmatic improvement. We designed and carried out a PHO coaching curriculum to supply a sturdy instructional and scientific expertise throughout the present resource-constrained atmosphere in Ethiopia. Education relied on visiting PHO college, a coaching attachment overseas, and extraordinary initiative from trainees. PHO coaching in Ethiopia is approaching sustainability by means of human useful resource improvement, and is accelerating the expansion of devoted PHO companies the place none existed 7 years in the past.

Mouse Adenosine Kinase (ADK) ELISA Kit

DLR-ADK-Mu-48T 48T
EUR 527
  • Should the Mouse Adenosine Kinase (ADK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Adenosine Kinase (ADK) in samples from tissue homogenates or other biological fluids.

Mouse Adenosine Kinase (ADK) ELISA Kit

DLR-ADK-Mu-96T 96T
EUR 688
  • Should the Mouse Adenosine Kinase (ADK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Adenosine Kinase (ADK) in samples from tissue homogenates or other biological fluids.

Human Adenosine Kinase (ADK) ELISA Kit

RD-ADK-Hu-48Tests 48 Tests
EUR 521

Human Adenosine Kinase (ADK) ELISA Kit

RD-ADK-Hu-96Tests 96 Tests
EUR 723

Mouse Adenosine Kinase (ADK) ELISA Kit

RD-ADK-Mu-48Tests 48 Tests
EUR 533

Mouse Adenosine Kinase (ADK) ELISA Kit

RD-ADK-Mu-96Tests 96 Tests
EUR 740

Human Adenosine Kinase (ADK) ELISA Kit

RDR-ADK-Hu-48Tests 48 Tests
EUR 544

Human Adenosine Kinase (ADK) ELISA Kit

RDR-ADK-Hu-96Tests 96 Tests
EUR 756

Mouse Adenosine Kinase (ADK) ELISA Kit

RDR-ADK-Mu-48Tests 48 Tests
EUR 557

Mouse Adenosine Kinase (ADK) ELISA Kit

RDR-ADK-Mu-96Tests 96 Tests
EUR 774

ADK antibody

70R-31777 100 ug
EUR 327
Description: Rabbit polyclonal ADK antibody

ADK Antibody

ABD3218 100 ug
EUR 438

ADK Antibody

36053-100ul 100ul
EUR 252

ADK antibody

10R-10414 100 ug
EUR 435
Description: Mouse monoclonal ADK antibody

ADK antibody

10R-10415 100 ug
EUR 435
Description: Mouse monoclonal ADK antibody

ADK antibody

10R-1774 100 ul
EUR 322
Description: Mouse monoclonal ADK antibody

ADK antibody

10R-1782 100 ul
EUR 322
Description: Mouse monoclonal ADK antibody

ADK Antibody

DF3218 200ul
EUR 304
Description: ADK Antibody detects endogenous levels of total ADK.

ADK Antibody

1-CSB-PA346232LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADK. Recognizes ADK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

ADK Antibody

1-CSB-PA247810
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ADK. Recognizes ADK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

ADK Antibody

1-CSB-PA152141
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADK. Recognizes ADK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

ADK Antibody

1-CSB-PA172054
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADK. Recognizes ADK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

ADK Conjugated Antibody

C36053 100ul
EUR 397

anti- ADK antibody

FNab00172 100µg
EUR 548.75
  • Immunogen: adenosine kinase
  • Uniprot ID: P55263
  • Gene ID: 132
  • Research Area: Metabolism
Description: Antibody raised against ADK

ADK Polyclonal Antibody

ES4763-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ADK from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

ADK Polyclonal Antibody

ES4763-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ADK from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

ADK Polyclonal Antibody

ABP53764-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human ADK at AA rangle: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of ADK from Human, Mouse, Rat. This ADK antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human ADK at AA rangle: 1-80

ADK Polyclonal Antibody

ABP53764-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human ADK at AA rangle: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of ADK from Human, Mouse, Rat. This ADK antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human ADK at AA rangle: 1-80

ADK Polyclonal Antibody

ABP53764-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human ADK at AA rangle: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of ADK from Human, Mouse, Rat. This ADK antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human ADK at AA rangle: 1-80

Human ADK Antibody

33145-05111 150 ug
EUR 261

Anti-ADK Antibody

PB10031 100ug/vial
EUR 334

Anti-ADK antibody

PAab00172 100 ug
EUR 386

Anti-ADK antibody

STJ91500 200 µl
EUR 197
Description: Rabbit polyclonal to ADK.

Anti-ADK antibody

STJ11100868 100 µl
EUR 413
Description: This gene an enzyme which catalyzes the transfer of the gamma-phosphate from ATP to adenosine, thereby serving as a regulator of concentrations of both extracellular adenosine and intracellular adenine nucleotides. Adenosine has widespread effects on the cardiovascular, nervous, respiratory, and immune systems and inhibitors of the enzyme could play an important pharmacological role in increasing intravascular adenosine concentrations and acting as anti-inflammatory agents. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-ADK antibody

STJ117217 100 µl
EUR 277
Description: This gene an enzyme which catalyzes the transfer of the gamma-phosphate from ATP to adenosine, thereby serving as a regulator of concentrations of both extracellular adenosine and intracellular adenine nucleotides. Adenosine has widespread effects on the cardiovascular, nervous, respiratory, and immune systems and inhibitors of the enzyme could play an important pharmacological role in increasing intravascular adenosine concentrations and acting as anti-inflammatory agents. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-ADK antibody

STJ117218 100 µl
EUR 277
Description: This gene an enzyme which catalyzes the transfer of the gamma-phosphate from ATP to adenosine, thereby serving as a regulator of concentrations of both extracellular adenosine and intracellular adenine nucleotides. Adenosine has widespread effects on the cardiovascular, nervous, respiratory, and immune systems and inhibitors of the enzyme could play an important pharmacological role in increasing intravascular adenosine concentrations and acting as anti-inflammatory agents. Multiple transcript variants encoding different isoforms have been found for this gene.

Adk/ Rat Adk ELISA Kit

ELI-24395r 96 Tests
EUR 886

ADK siRNA

20-abx900194
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADK siRNA

20-abx906873
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADK siRNA

20-abx906874
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ADK

YF-PA23185 50 ul
EUR 334
Description: Mouse polyclonal to ADK

Adenosine Kinase (ADK) Antibody

20-abx119058
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

20-abx129762
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Adenosine Kinase (ADK) Antibody

20-abx137257
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

20-abx171082
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Adenosine Kinase (ADK) Antibody

abx148019-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

20-abx101253
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Adenosine Kinase (ADK) Antibody

abx033170-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

abx033170-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

20-abx007599
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

abx018200-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

abx018201-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

20-abx175249
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Adenosine Kinase (ADK) Antibody

20-abx328118
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

20-abx214242
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

20-abx214243
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

20-abx338791
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

abx230172-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

ADK Antibody, HRP conjugated

1-CSB-PA346232LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADK. Recognizes ADK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ADK Antibody, FITC conjugated

1-CSB-PA346232LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADK. Recognizes ADK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ADK Antibody, Biotin conjugated

1-CSB-PA346232LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADK. Recognizes ADK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal ADK Antibody (C-term)

APR07051G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADK (C-term). This antibody is tested and proven to work in the following applications:

Adenosine Kinase (ADK) Antibody (HRP)

20-abx334581
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody (FITC)

20-abx334582
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody (Biotin)

20-abx334583
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human ADK Antibody (Biotin Conjugate)

33145-05121 150 ug
EUR 369

Anti-ADK Antibody (monoclonal, 7F4)

M02193 100ug/vial
EUR 334

ADK cloning plasmid

CSB-CL346232HU-10ug 10ug
EUR 401
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1038
  • Sequence: atgacgtcagtcagagaaaatattctctttggaatgggaaatcctctgcttgacatctctgctgtagtggacaaagatttccttgataagtattctctgaaaccaaatgaccaaatcttggctgaagacaaacacaaggaactgtttgatgaacttgtgaaaaaattcaaagtcg
  • Show more
Description: A cloning plasmid for the ADK gene.

ADK Protein (Recombinant)

20-abx073897
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

ADK Rabbit pAb

A15023-100ul 100 ul
EUR 308

ADK Rabbit pAb

A15023-200ul 200 ul
EUR 459

ADK Rabbit pAb

A15023-20ul 20 ul
EUR 183

ADK Rabbit pAb

A15023-50ul 50 ul
EUR 223

ADK Rabbit pAb

A15024-100ul 100 ul
EUR 308

ADK Rabbit pAb

A15024-200ul 200 ul
EUR 459

ADK Rabbit pAb

A15024-20ul 20 ul
EUR 183

ADK Rabbit pAb

A15024-50ul 50 ul
EUR 223

ADK Blocking Peptide

DF3218-BP 1mg
EUR 195

Anti-ADK (4E7)

YF-MA11836 100 ug
EUR 363
Description: Mouse monoclonal to ADK

Human ADK AssayLite Antibody (FITC Conjugate)

33145-05141 150 ug
EUR 428

Human ADK AssayLite Antibody (RPE Conjugate)

33145-05151 150 ug
EUR 428

Human ADK AssayLite Antibody (APC Conjugate)

33145-05161 150 ug
EUR 428

Human ADK AssayLite Antibody (PerCP Conjugate)

33145-05171 150 ug
EUR 471

Adenosine Kinase (ADK) Polyclonal Antibody (Human)

4-PAC281Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADK (Lys94~Pro339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosine Kinase (ADK)

Adenosine Kinase (ADK) Polyclonal Antibody (Mouse)

4-PAC281Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADK (Met1~His361)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Adenosine Kinase (ADK)

Rat ADK shRNA Plasmid

20-abx984966
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ADK ELISA KIT|Human

EF007632 96 Tests
EUR 689

Human ADK shRNA Plasmid

20-abx950091
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ADK protein (His tag)

80R-1322 50 ug
EUR 305
Description: Purified recombinant Human ADK protein

Mouse ADK shRNA Plasmid

20-abx969053
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ADK Recombinant Protein (Human)

RP000610 100 ug Ask for price

Recombinant Adenosine Kinase (ADK)

4-RPC281Hu01
  • EUR 472.74
  • EUR 229.00
  • EUR 1497.76
  • EUR 565.92
  • EUR 1031.84
  • EUR 379.00
  • EUR 3594.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P55263
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Adenosine Kinase expressed in: E.coli

Recombinant Adenosine Kinase (ADK)

4-RPC281Mu01
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P55264
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 70.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Adenosine Kinase expressed in: E.coli

ADK Recombinant Protein (Rat)

RP189356 100 ug Ask for price

ADK Recombinant Protein (Mouse)

RP114533 100 ug Ask for price

ADK Recombinant Protein (Mouse)

RP114536 100 ug Ask for price

Adenosine Kinase (ADK) Polyclonal Antibody (Human), APC

4-PAC281Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADK (Lys94~Pro339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosine Kinase (ADK). This antibody is labeled with APC.

Adenosine Kinase (ADK) Polyclonal Antibody (Human), Biotinylated

4-PAC281Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADK (Lys94~Pro339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosine Kinase (ADK). This antibody is labeled with Biotin.

Adenosine Kinase (ADK) Polyclonal Antibody (Human), Cy3

4-PAC281Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADK (Lys94~Pro339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosine Kinase (ADK). This antibody is labeled with Cy3.

Adenosine Kinase (ADK) Polyclonal Antibody (Human), FITC

4-PAC281Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADK (Lys94~Pro339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosine Kinase (ADK). This antibody is labeled with FITC.

Adenosine Kinase (ADK) Polyclonal Antibody (Human), HRP

4-PAC281Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADK (Lys94~Pro339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosine Kinase (ADK). This antibody is labeled with HRP.

Adenosine Kinase (ADK) Polyclonal Antibody (Human), PE

4-PAC281Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADK (Lys94~Pro339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosine Kinase (ADK). This antibody is labeled with PE.

Adenosine Kinase (ADK) Polyclonal Antibody (Mouse), APC

4-PAC281Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADK (Met1~His361)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Adenosine Kinase (ADK). This antibody is labeled with APC.

Adenosine Kinase (ADK) Polyclonal Antibody (Mouse), Biotinylated

4-PAC281Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADK (Met1~His361)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Adenosine Kinase (ADK). This antibody is labeled with Biotin.

Adenosine Kinase (ADK) Polyclonal Antibody (Mouse), Cy3

4-PAC281Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADK (Met1~His361)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Adenosine Kinase (ADK). This antibody is labeled with Cy3.

Adenosine Kinase (ADK) Polyclonal Antibody (Mouse), FITC

4-PAC281Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADK (Met1~His361)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Adenosine Kinase (ADK). This antibody is labeled with FITC.

Adenosine Kinase (ADK) Polyclonal Antibody (Mouse), HRP

4-PAC281Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADK (Met1~His361)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Adenosine Kinase (ADK). This antibody is labeled with HRP.

Adenosine Kinase (ADK) Polyclonal Antibody (Mouse), PE

4-PAC281Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADK (Met1~His361)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Adenosine Kinase (ADK). This antibody is labeled with PE.

Human Adenosine Kinase (ADK) Protein

20-abx065151
  • EUR 662.00
  • EUR 272.00
  • EUR 2026.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse Adenosine Kinase (ADK) Protein

20-abx167298
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

[KO Validated] ADK Rabbit pAb

A19992-100ul 100 ul
EUR 410

[KO Validated] ADK Rabbit pAb

A19992-200ul 200 ul
EUR 571

[KO Validated] ADK Rabbit pAb

A19992-20ul 20 ul
EUR 221

[KO Validated] ADK Rabbit pAb

A19992-50ul 50 ul
EUR 287

Escherichia coli Adenylate kinase (adk)

1-CSB-RP163274Ba
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 27.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Escherichia coli Adenylate kinase(adk) expressed in E.coli

Shigella flexneri Adenylate kinase (adk)

1-CSB-EP769467SZB
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 43.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Shigella flexneri Adenylate kinase(adk) expressed in E.coli

Mycobacterium tuberculosis Adenylate kinase (adk)

1-CSB-EP404243MON
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 36.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mycobacterium tuberculosis Adenylate kinase(adk) expressed in E.coli

ADK ORF Vector (Human) (pORF)

ORF000204 1.0 ug DNA
EUR 95

Adk ORF Vector (Mouse) (pORF)

ORF038179 1.0 ug DNA
EUR 506

Adk ORF Vector (Mouse) (pORF)

ORF038180 1.0 ug DNA
EUR 506

Adk ORF Vector (Rat) (pORF)

ORF063120 1.0 ug DNA
EUR 506

Recombinant Aeromonas Hydrophila adk Protein

VAng-Lsx0944-1mgEcoli 1 mg (E. coli)
EUR 3736
Description: Aeromonas Hydrophila Adenylate kinase, recombinant protein.

Recombinant Aeromonas Hydrophila adk Protein

VAng-Lsx0944-500gEcoli 500 µg (E. coli)
EUR 2530
Description: Aeromonas Hydrophila Adenylate kinase, recombinant protein.

Recombinant Aeromonas Hydrophila adk Protein

VAng-Lsx0944-50gEcoli 50 µg (E. coli)
EUR 1723
Description: Aeromonas Hydrophila Adenylate kinase, recombinant protein.

Recombinant Aeromonas Salmonicida adk Protein

VAng-Lsx1330-1mgEcoli 1 mg (E. coli)
EUR 3736
Description: Aeromonas Salmonicida Adenylate kinase, recombinant protein.

Recombinant Aeromonas Salmonicida adk Protein

VAng-Lsx1330-500gEcoli 500 µg (E. coli)
EUR 2530
Description: Aeromonas Salmonicida Adenylate kinase, recombinant protein.

Recombinant Aeromonas Salmonicida adk Protein

VAng-Lsx1330-50gEcoli 50 µg (E. coli)
EUR 1723
Description: Aeromonas Salmonicida Adenylate kinase, recombinant protein.

ADK ELISA Kit (Human) (OKCD00681)

OKCD00681 96 Wells
EUR 831
Description: Description of target: ATP dependent phosphorylation of adenosine and other related nucleoside analogs to monophosphate derivatives. Serves as a potential regulator of concentrations of extracellular adenosine and intracellular adenine nucleotides. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.59 ng/mL

ADK ELISA Kit (Mouse) (OKCD08065)

OKCD08065 96 Wells
EUR 1001
Description: Description of target: Atp dependent phosphorylation of adenosine and other related nucleoside analogs to monophosphate derivatives. serves as a potential regulator of concentrations of extracellular adenosine and intracellular adenine nucleotides.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

ADK ELISA Kit (Mouse) (OKDD00851)

OKDD00851 96 Wells
EUR 988
Description: Description of target: Atp dependent phosphorylation of adenosine and other related nucleoside analogs to monophosphate derivatives. serves as a potential regulator of concentrations of extracellular adenosine and intracellular adenine nucleotides.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.054ng/mL

ADK ELISA Kit (Human) (OKEH08172)

OKEH08172 96 Wells
EUR 1092
Description: Description of target: This gene an enzyme which catalyzes the transfer of the gamma-phosphate from ATP to adenosine, thereby serving as a regulator of concentrations of both extracellular adenosine and intracellular adenine nucleotides. Adenosine has widespread effects on the cardiovascular, nervous, respiratory, and immune systems and inhibitors of the enzyme could play an important pharmacological role in increasing intravascular adenosine concentrations and acting as anti-inflammatory agents. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055ng/mL

Human ADK AssayLite FITC-Conjugated Antibody ICC Kit

ICC33145F Kit
EUR 406

Adenosine Kinase (ADK) Polyclonal Antibody (Human), APC-Cy7

4-PAC281Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADK (Lys94~Pro339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosine Kinase (ADK). This antibody is labeled with APC-Cy7.

Adenosine Kinase (ADK) Polyclonal Antibody (Mouse), APC-Cy7

4-PAC281Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADK (Met1~His361)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Adenosine Kinase (ADK). This antibody is labeled with APC-Cy7.
Four physicians have accomplished complete PHO subspecialty coaching primarily based primarily in Ethiopia, and all have remained native. Former fellows at the moment are main two PHO facilities in Ethiopia with a mixed capability of 64 inpatient beds and over 800 new diagnoses per 12 months; an extra former fellow is creating a pediatric most cancers program in Nairobi, Kenya. Two fellows at the moment are in coaching. Program management, instructing, and advocacy are being transitioned to those physicians. Despite myriad challenges, a subspecialty PHO coaching program was efficiently carried out in a low-income nation.
Back to top